Die tiefere Bedeutung der DNA

Die tiefere Bedeutung der DNA

Die tiefere Bedeutung der DNA

Im Laufe eines Tages gibt es viele Dinge, die wir tun ohne darüber bewusst nachzudenken oder wahrzunehmen. Wenn man jedoch einen näheren Blick auf diese Dinge wirft erweisen sie sich als faszinierend und erstaunlich. Zumindest reflektiert dies meine Erfahrung, als ich im Rahmen meines Studiums automatische Prozesse und Reflexe wie Laufen, Bewegung und Atmung studierte. Eine andere, sehr faszinierende Sache ist die Kommunikation, das Sprechen und Verstehen. Denken Sie darüber nach: die Worte, welche hier geschrieben stehen sind in Wirklichkeit nichts weiter als schwarze Punkte auf weißem Hintergrund! Wenn Wörter auf Papier geschrieben werden ist dies in Wahrheit nichts weiter als ein paar Linien zu ziehen von oben nach unten, von links nach rechts…
Wie ist es dann also möglich, dass ein paar schwarze Punkte und Linien, welche offensichtlich aus sich heraus keine Bedeutung haben, gelesen und verstanden werden können? Die Antwort ist, weil sich hinter diesen Wörtern ein Verstand verbirgt, der ihnen Bedeutung gibt. Das kommt dadurch, das ich gelernt habe, dass das Wort “Hund” ein Tier mit vier Beinen ist; wenn ich an ein anderes Tier denke, welches in Afrika lebt, sehr groß ist und einen sehr langen Hals hat verbinde ich dieses Bild mit dem Wort “Giraffe”.
Dieser Prozess kann als “Codieren” bezeichnet werden. Ein Gedanke wird in ein Wort in einer bestimmten Sprache codiert. Es ist die Umformung eines Gedankens, welche etwas bedeutungsloses nutzt, so wie z.B. schwarze Punkte um es zu etwas bedeutungsvollem zu machen und eine Botschaft zu übermitteln.

Das ist allerdings nur der erste Teil. Denn was würde es bringen, wenn ich schreiben und sprechen kann, aber ich die einzige Person auf dieser Welt bin, die diese Sprache beherrscht?! Genau so wie Wörter codiert werden und Bedeutung bekommen muss der Empfänger dieser Wörter sie entschlüsseln (decodieren) können! Er muss das Wort sehen und die Bedeutung “entfalten” die der Autor in das Wort “gefaltet” hat. Das funktioniert natürlich nur, wenn beide, Autor und Empfänger, den selben Schlüssel für das Codieren und Decodieren benutzen. Zum Beispiel gibt es viele Bücher in Hindi, in welchen der Autor seine Gedanken kunstvoll ausgedrückt hat und diese in gewisse Wörter und Sätze “hinein gefaltet” hat. Wenn ich diese großen Werke sehe und die Wörter, welche eine besondere Bedeutung und Botschaft mit sich tragen, habe ich keine Möglichkeit diese Wörter zu entschlüsseln! Für mich sehen sie nur wie schwarze Punkte und Linien aus! Ich nehme an, dass sie Bedeutung haben, denn ich sehe, dass die Buchstaben mit Sorgfalt von menschlicher Hand geformt wurden und nicht einfach willkürlich entstanden sind, doch ohne den richtigen Schlüssel ist es für mich unmöglich diese Wörter zu entschlüsseln.

 

Jetzt wollen wir einen Blick auf die DNA werfen und übertragen, was wir soeben entdeckt haben.

DNA ist eine Abkürzung und steht für Desoxyribonucleinsäure (Eng.: deoxyribonucleic acid), welche die chemische Struktur beschreibt. Sehr wahrscheinlich haben Sie schon in vielen Fotos die spiralförmige Struktur der DNA gesehen, welche eine “α-Helix” Struktur genannt wird. Die chemischen Struktur der DNA beinhaltet vier verschiedene Basen: Adenosin (A), Guanin (G), Thymin (T) and Cytosin (C). Diese vier Basen repräsentieren “Buchstaben” mit denen der Code des Lebens verschlüsselt ist. Die DNA ist ein langer Strang welcher aus einer Abfolge dieser vier Buchstaben besteht. Es könnte zum Beispiel so aussehen: GATTAGACGTCGATCGATTAA… Diese vier Buchstaben werden benutzt um “Wörter” und “Sätze” zu bilden, welche den Code des Lebens bilden. Von dem größten Tier zu der kleinsten Zelle, alle lebenden Kreaturen dieser Welt tragen den Code des Lebens in sich! Doch wie ist es möglich, dass eine bestimmte Abfolge von Basen, welche offensichtlich in sich selber keine Bedeutung haben, eine Botschaft übermitteln, welche sogar eine Botschaft des Lebens ist? In gleicher Weise wie andere Botschaften muss auch diese Botschaft gefaltet und entfaltet worden sein, codiert und decodiert!

Lassen Sie uns einen Blick auf den Entschlüsselungsprozess werfen:
Der Entschlüsselungsprozess ist ein Prozess der als “Translation” bekannt ist. Er wird “Translation” genannt, denn der Prozess übersetzt (Eng.: translation) den DNA-Code in Proteine. Bevor jedoch der Prozess der Translation beginnen kann wird eine Kopie der originalen DNA gemacht. DNA wird transkribiert in eine “Botschafter” (Eng.: messenger) – mRNA durch einen Prozess der als “Transkription” bekannt ist. Anstelle von Thymin (T) benutzt die RNA Uracil (U). Doch abgesehen von dieser einen anderen Base und ein paar chemischen Unterschieden können wir uns die mRNA als eine Kopie der DNA vorstellen welche exakt den gleichen Code der DNA trägt.

Nachdem die Kopie, die mRNA, gebildet wurde beginnt sich eine große Fabrik um die Kopie herum zu bilden, welche “Ribosom” genannt wird und aus einer kleinen und einer großen Untereinheit besteht. Diese Fabrik funktioniert sehr ähnlich wie ein Fließband. Die mRNA wird durch das Ribosom gezogen und dabei entschlüsselt /decodiert. Der Code der mRNA wird gepaart mit einem besonderen “Anticodon”. Dieser Anticodon befindet sich auf einem Molekül namens tRNA. Je nach Anticodon der t2000px-ribosome_mrna_translation_enRNA wird sie durch Enzyme spezifisch mit einer Aminosäure gekoppelt. Aminosäuren sind die kleinsten Bausteine für Proteine. Und Proteine sind wiederum das, was Leben ausmacht. Proteine geben Struktur, sie können Material transportieren, sie können als Signale oder Rezeptoren dienen, sie können Pumpen bilden, Teile eines Motors sein, usw.
Jede einzelne tRNA mit ihrem Anticodon passt genau auf drei Basen der mRNA. Daher ist der Code der DNA/mRNA auch als “Triplet-Code” bekannt. Jede tRNA translatiert (übersetzt) daher drei Buchstaben in eine bestimmte Aminosäure.
Währen die mRNA wie ein Fließband durch die Fabrik gezogen wird, wird screen-shot-2016-11-11-at-16-55-46der Code der mRNA mit dem korrekten Anticodon einer spezifischen tRNA verbunden. Die tRNA verbindet dann ihre Aminosäure mit der Kette der Aminosäuren, welche zuvor gebildet wurde, und löst sich dann wieder von der mRNA ab um Platz zu schaffen für die tRNA, welche auf die nächsten drei Buchstaben passt.

Auf diese Weise wird eine lange Kette von Aminosäuren gebildet, welche dann drei-dimensional zu einem Protein gefaltet wird. Die Geschwindigkeit, mit welche dieser komplexe Prozess eine Kette von Amiosäuren bildet kann bis zu 40 Aminosäuren pro Seunde schnell sein![1] Da drei Buchstaben eine Aminosäure codieren, können bis zu 120 Buchstaben pro Sekunde gelesen werden! Ist das nicht beeindruckend?! Der insulinhexamerProzess, welcher mit der Anfertigung einer Kopie der DNA beginnt bis hin zum Falten des Proteins wird als “Protein Biosynthese” bezeichnet.

Wenn wir die Basen in der DNA mit einem Buchstaben vergleichen, können wir sagen, dass drei Buchstaben ein Wort ergeben welches eine Aminosäure codiert. Ein Satz, bestehend aus mehreren Wörtern, würde dann ein Protein codieren. Proteine können in der Länge variieren von dem größten Protein in unserem Körper, Titin, welches aus screen-shot-2016-11-11-at-16-55-49~27,000 Aminosäuren besteht[2], bis zu kleineren Proteinen wie Insulin, welches aus 51 Aminosäuren besteht[3]. 

Wissenschaftlern war es möglich die Sprache, welche die DNA benutzt, zu verstehen und zu lernen, da sie in ihrem Labor den Prozess der Entschlüsselung beobachten konnten. Sie konnten den Prozess der Translation beobachten und lernen, wie dieser Prozess die Botschaft entfaltet, welcher die DNA enthält und damit etwas bedeutungsloses in etwas bedeutungsvolles verwandelt. Sie sahen, wie eine Anordnung von Basen, welche in sich selber keine Bedeutung haben, sich in etwas bemerkenswertes wie Proteine verwandelten, welche uns ermöglichen zu hören, uns zu bewegen, zu sehen, zu reden, zu denken… Basierend auf der Beobachtung, dass drei Basen eine Aminosäure codiren,wurde ein Diagramm 512px-aminoacids_tableentworfen, welche zeigt, wie die mRNA/DNA entschlüsselt wird. Diese “Code-Sonne” illustriert den “genetischen Code” und wird von innen nach außen gelesen um zu erfahren, welcher Triplet-Code welche Aminosäure codiert.

Wir haben gerade einen Blick auf den hoch komplexen Prozess der Translation geworfen, welcher den Teil der Entschlüsselung der Botschaft darstellt. Doch wahrscheinlich, genauso wie ich fragen Sie sich: wo kam der Entschlüsselungscode eigentlich her? Warum wird für den Code “ACC” genau die Aminosäure Asparagin screen-shot-2016-11-11-at-16-55-55(ASN) und nicht z.B. Histidin (HIS) benutzt wird? Wo kommen die tRNA Moleküle her und woher kommen die Enzyme, die charge_trnaeine spezifische tRNA mit einer spezifischen Aminosäure verbinden? Jeweils die tRNA und die Enzyme kommen beide von der DNA! Die tRNA, welche den Anticodon beinhaltet, wird transkribiert von der DNA und die Enzyme, die die richtige Aminosäure mit der tRNA verbindet, welche den richtigen Anticodon trägt, sind Proteine und werden wie alle andere Proteine auch aus dem Code der DNA hergestellt!

Hier haben wir dieses hoch komplexe Molekül mit dem Namen DNA, welches von Watson und Crick screen-shot-2016-11-11-at-16-59-21gerade mal vor 63 Jahren entdeckt wurde. Ein Molekül, welches chemische Basen in einer ganz bestimmten Reihenfolge enthält um eine Botschaft zu überbringen: den Code des Lebens. Doch wie vielmehr ist es eine Botschaft, die sogar den Schlüssel zum Entschlüsseln der eigenen Botschaft mit sich trägt! Wie faszinierend ist das?!

 

Lassen Sie uns zusammenfassen, was wir soweit gelernt haben:
Wenn wir kommunizieren codieren wir Gedanken in etwas, was von sich aus keine Bedeutung hat. Es können schwarze Punkte oder Linien sein, Rauch oder Licht. Allerdings bleiben diese Dinge nicht schwarze Punkte, Linien, Rauch oder Licht. Sie werden zu Wörtern, Sätze, Rauchzeichen oder Lichtsignale. Dies ist der Fall, da sich hinter diesen schwarzen Punkten und Linien ein Verstand verbirgt, welcher diesen Dingen Bedeutung verleiht. Um die Botschaft wiederum zu entfalten bedarf es eines Schlüssels, den Empfänger und Sender beide haben müssen.

Zur gleichen Zeit existiert dieses faszinierende Molekül Namens DNA. Es ist auch bekannt als das “Molekül des Lebens”, denn es trägt den “Code des Lebens”. Die DNA benutzt vier chemische Basen, welche als Buchstaben genutzt werden um eine Botschaft zu übertragen, doch von sich aus, in einem anderen Setting oder Zusammenhang, keine Bedeutung in sich tragen.
Die DNA wird entschlüsselt durch einen Prozess, bekannt als Translation. Durch diesen Prozess werden Proteine gebildet. Für diesen Prozess wird eine mRNA (eine Kopie der DNA), ein Ribosom, tRNA, Aminosäuren und Energie in Form von ATP benötigt. Der Code des Lebens beinhaltet sogar seinen eigenen Schlüssel, da die tRNA und die Enzyme, welche die richtige tRNA mit der richtigen Aminosäure verbinden, auch aus dem Code der DNA hergestellt werden.

Die heute verbreitete Ansicht der Wissenschaft ist, dass am Anfang des Lebens ein einfacher genetischer Code durch Zufall entstand. Auch wenn diese Ansicht davon ausgeht, dass sich aufgrund des etwas geringeren komplexen Aufbau der chemischen Struktur zuerst ein RNA Code formte, können wir es für unsere Zwecke einfach auch als “genetischen Code” bezeichnen. Nach der vermuteten Bildung wird angenommen, dass natürliche Auslese den Code weiter selektiert hat und erweitert hat.[4] Doch wie wird ein “einfacher” genetischer Code definiert? Wie viele Proteine hätte dieser Code codieren müssen um chemische Moleküle in Leben zu verwandeln?

Viren sind Organismen die sich an der Grenze des Lebens befinden. Sie besitzen nicht die Möglichkeit sich alleine zu vermehren, im Gegensatz zu Bakterien. Aufgrund dessen, dass ihnen essenzielle Komponenten für die Replikation fehlen, wie Ribosome, brauchen sie eine Wirtszelle um zu reproduzieren und neue Viren zu bilden. Hier ist der Virus mit dem kleinsten bekannten Genom: der Hepatitis B Virus. Es besitzt ein Genom mit der Größe von 3.2 kb (Kilobasen). Das sind 3200 Basen! 3200 Basen ohne die Fähigkeit zu besitzen sein eigenes Genom zu kopieren!

Schon früh wurde mir bewusst: sollte es selbst die Möglichkeit gegeben haben, dass ein solcher Code aus Zufall entstand, musste diese Wahrscheinlichkeit extrem gering gewesen sein.
Dies war allerdings erst, als ich einen näheren Blick auf die Dinge geworfen habe, die wir tun, ohne näher darüber nachzudenken, als ich etwas erstaunliches bemerkte! Eine Botschaft wird erst eine Botschaft weil ein Verstand dahinter ist. Ein Verstand, welcher aus etwas bedeutungslosem etwas bedeutungsvolles macht. Das war als ich realisierte, dass das derzeitige Verständnis des Ursprungs der DNA mit grundlegenden Mängeln behaftet ist. Es ist unmöglich, dass eine Botschaft, welche sogar den eigenen Schlüssel zum Entschlüsseln mit sich trägt, aus Zufall ins Dasein gesprungen sei. Genauso wie mit jeder anderen Botschaft, welche Material benutzt, das von sich aus keine Bedeutung hat, muss es auch hinter dieser Botschaft ein Verstand geben! Gerade erst bei der DNA, die weit aus komplexer ist als nur ein einfaches Buch mit Wörtern!

Während die Menschheit nach außerirdischem Leben sucht,[5] nach genau den gleichen Zeichen von Intelligenz Ausschau hält, schauen sie in die falsche Richtung. Vielleicht sollten wir nicht so sehr in das Weltall schauen, um zu sehen ob Hinweise für außerirdische Intelligenz gefunden werden können, vielleicht sollten wir viel mehr nach innen schauen!
Und ist es nicht erstaunlich, dass im Licht der Prinzipien der Kommunikation, die wir oben gesehen haben, alle Lebewesen einen Code in der selben Sprache besitzen?! Würde es nicht Sinn machen, dass wenn ein Verstand hinter diesem Code steckt, auch der gleiche Code in verschiedenen Formen des Lebens wieder zu finden ist?

Von farbenprächtigen Blumen zu großen Bäumen, von Plankton im Ozean zu Löwen am Land, von langsamen, wachsamen Chamäleons zu schnellen und agilen Geparden, von einzelligen Organismen bis zu uns – Menschen! Alle tragen einen Code in der selben Sprache! Alle tragen die Aufschrift jemanden, der wahrhaftig erhaben ist.

“Die Himmel erzählen die Herrlichkeit Gottes, und die Ausdehnung verkündet seiner Hände Werk. Ein Tag berichtet es dem anderen, und eine Nacht meldet der anderen die Kunde davon. Keine Rede und keine Worte, doch gehört wird ihre Stimme.” Psalm 19:1-4

 
 
 
 

Fußnoten:
[1] W. H. Freeman, ”Protein Synthesis Requires the Translation of Nucleotide Sequences Into Amino Acid Sequences”, Bioche-mistry 5th edition, zugegriffen am 16. Oktober 2016, https://www.ncbi.nlm.nih.gov/books/NBK22421/
[2] Sela BA, “Titin: Some aspect of the largest protein in the body”, zugegriffen am 16. Oktober 2016, https://www.ncbi.nlm.nih.gov/pubmed/12187564
[3] Drug Information Portal, “Insulin Human”, zugegriffen am 16. Oktober 2016, https://druginfo.nlm.nih.gov/drugportal/rn/11061-68-0
[4] “How could DNA have evolved?”, Evolution FAQ, zugegriffen am 17. Oktober 2016, http://evolutionfaq.com/faq/how-could-dna-have-evolved
[5]NPR, ”Scientists Looking For Alien Life Investigate ‚Interesting‘ Signal From Space”, zugegriffen am 17. Oktober 2016, http://www.npr.org/sections/thetwo-way/2016/08/30/491924071/scientists-looking-for-alien-life-investigate-interesting-signal- from-space

 

Für weitere Informationen empfehle ich diese 8-teilige Vortragsreihe von Prof. Dr. Walt Veith. Er selbst war ein starker Befürworter der Evolutionstheorie bis er bemerkte, dass dieser Theorie einige fundamentale Probleme zugrunde liegen, die normalerweise auf der Seite gelassen werden. In diesem Video zeigt er die Probleme, die “spontane Entstehung des Lebens” mit sich bringt und zeigt wie Genetik ein neues Verständnis mit sich bring, das noch vor 100 Jahren unvorstellbar gewesen wäre: https://youtu.be/t-_RiSxW3Ac?list=PLBTGSIc1rZPKInCQ6YJ3EduopNtaOyIjz

animal-1395507622m8j

 

Wenn Sie in Deutschland wohnen und gerne kostenlos ein Buch zugeschickt bekommen möchten oder aber an lokalen Gesundheitsvorträgen oder auch Bibelstunden teilnehmen wollen bitten klicken Sie HIER

By | 2016-11-17T20:58:58+00:00 November 11th, 2016|Categories: Artikel, Blog|Tags: , , , , , |0 Comments

Leave A Comment